Smart labels could tell you when to toss food and makeup, as this video shows

Is it safe to eat the leftover cheese in the fridge or put on the eye shadow that has been in your cabinet for several years? A smart label could help. That’s the hope of a team of researchers who have developed a new sensor containing nanostructures that change color when they bind to compounds that indicate spoilage or contamination by bacteria. Whereas currently available sensors use liquid solutions that migrate on channels, the newly developed sensor has all the reagents incorporated in a postage stamp–sized piece of paper. This means it can be directly applied tothe samples that have to be tested; for example, it could be added to makeup packaging or dabbed onto leftover food. The researchers, who will present their results today at the 254th National Meeting & Exposition of the American Chemical Societyin Washington, D.C., have already used the paper sensor to detect antioxidant compounds in tea and wine, which could be used for authentication purposes. But the sensor, they add, could also be used to identify new medicinal plants or natural sources of antioxidants in remote areas such as the Amazon rainforest.

dpboss satta matka satta matka

The Germans torpedoed a ship during World War II. The wreck is now revealing secrets about underwater mudslides

In 1942, in the midst of World War II, the oil tanker Virginia was anchored off the mouth of the Mississippi River in the Gulf of Mexico, waiting to unload its cargo in nearby New Orleans. It never made it. Three torpedoes from a German submarine, the U-507, caused the ship to become engulfed in flames, sinking it and killing 27 of its crew.

For nearly 60 years, the Virginia rested forgotten on the sea floor. Its vacant decks became decorated with coral and its portholes housed small fish. Over time, a multibillion-dollar offshore energy industry boomed around it.

Then, in 2001, an oil and gas exploration crew discovered the wreck while using sonar to scan the sea floor. Now, the Virginia is once again serving as a workhorse: Instead of hauling oil, however, the tanker is helping archaeologists and geologists understand the Gulf’s underwatermudslides. The sometimes massive slides can threaten historic wrecks and can cause catastrophic damage to oil pipelines and wells.

In particular, the wreck’s movements over the past 16 years are helping researchers understand how even relatively modest changes in the weather, not just major events like hurricanes, are reshaping the seafloor.

A slide hotspot

The Virginia lies on the edge of the Gulf’s continental shelf, in about 200 meters of water just off the Louisiana coast. It’s a hot spot for underwatermudslides, according to geologist Sam Bentley of Louisiana State University(LSU) in Baton Rouge, because the Mississippi River deposits large amounts of loose sediment in the area.The sediments build up over time, forming giant lobes that can break apart and slide down the shelf.

Such slides worry regulators and the oil and gas industry for at least two reasons. One is they cause sediment to slip from beneath seafloor pipes, leaving them suspended in the water and more vulnerable to breaks. The other is that the slides—which can be 30 meters thick—can shear through pipelines and other infrastructure. In 2004, for example, Hurricane Ivan triggered a mudslide that violently damaged 16 oil wells and created leaks.

The wreck’s discovery has provided geologists with some unexpected insight into how fast these lobes can move. In 2006, archaeologists with the federal government—which manages areas more than 5 kilometers offshore—set out to survey the Virginia. What they found mystified them: the 10,000-ton wreck had moved 370 meters seaward from its location in a 2004 mapping effort.

The likely cause, the researchers believed, was hurricanes that violently stormed through the Gulf in 2004 and 2005. Geologists knew that severe storms create large waves that, in turn, produce pressure differences on the sea floor. This buffeting causes naturally occurring methane bubbles in the seabed sediments to contact and expand, liquefying the mud around them. The process unleashes mudslides—which can carry even a 150-meter-long wreck along for the ride.

In 2017, when another team of researchers from the U.S. Geological Survey (USGS) returned to survey the wreck, they found it had moved an additional 60 meters seaward. Again, the scientists puzzled: This time, there had been no major storms to propel the movement.

Cold science

A recent study led by LSU’s Bentley might explain what is happening. In 2012, the federal Bureau of Ocean Energy Management (BOEM), which oversees offshore oil operations in federal waters, funded Bentley and researchers at the USGS to study mudslides in a 100-square-kilometer section near the Mississippi delta, which is dotted with numerous oil and gas wells and crisscrossed by pipelines.

The team mapped potential mudslide hotspots, extracted 9-meter-long cores from the sea floor, and measured movements of ocean floor sediments. They also examined weather and other records to see what might be driving sediment movements in the absence of hurricanes or other major storms.

One conclusion: Masses of cold air that regularly move over the gulf in the winter can stir up waves and pressure differences that can help push the sediment seawards at rates of up to a meter per year. The cold fronts could help explain the Virginia’s recent movements, Bentley says. “It would have to be something less energetic than a hurricane that was causing [the movement], so the next thing down from that are winter cold fronts.”

Management implications

The findings have implication for both efforts to prevent oil spills and to protect historic wrecks. Under federal law, offshore oil and gas companies are required to protect cultural artifacts from industrial operations. In the Virginia’s case, for example, BOEM barred companies from drilling, running pipelines, or dropping anchors within 300 meters of the wreck. But a moving wreck complicates industry efforts to stay out of that buffer zone.

The rusting hulk could also pose a substantial threat to pipelines or other infrastructure that was originally far downslope. Luckily, researchers say there are no pipelines in the immediate vicinity of Virginia.

Researchers note, however, that there haven’t been systematic surveys of wrecks or slides in the Gulf of Mexico since the 1970s, so there could be unknown threats sitting in the deep. To fill that knowledge gap, Bentley is hoping BOEM will support expanding his mudslide study to a larger area covering some 2000 square kilometers. And archaeologist Douglas Jones, who works out of BOEM’s office in New Orleans, Louisiana, is proposing a study that would identify other wrecks in slide-prone areas.

In the meantime, researchers plan to keep an eye on the Virginia, which they say has opened a door to better understanding the complexity and instability of the Gulf’s sea floor. Where the wreck will go next, they say, will depend on the natural forces that can be difficult to predict.

U.S. marine seismologists fear loss of research ship

The R/V Marcus G. Langseth is a remarkable research ship. The 70-meter vessel, owned by the National Science Foundation (NSF) and operated by Columbia University’s Lamont-Doherty Earth Observatory (LDEO) in Palisades, New York, can tow long chains of floating acoustic receivers, which catch seismic reflections off the ocean floor and the layers of marine sediments below it when an array of airguns are set off in the water. Using these reflections, researchers can build 3D pictures of structures like subduction zones, the regions where one tectonic plate dives below another, setting off large earthquakes and tsunamis in the process. Yet these days, thanks to tight NSF budgets, the Langseth typically has another view: a New York dockyard. Last year, it spent only 128 days at sea.

And much to their chagrin, marine seismologists may lose the services of the Langseth altogether. NSF is reviewing proposals, due on 21 August, that would deal with a $3.5 million gap between the $13.5 million cost of operating the ship and the $10 million that NSF is willing to pay. The Langseth has been in the crosshairs ever since 2015, when an influential “Sea Change” report—the ocean sciences decadal survey sponsored by the National Academies of Science, Engineering, and Medicine—recommended that NSF trim its ocean infrastructure in favor of more research support. If an academic institution or consortium is willing to take over the ship and provide NSF with just $10 million worth of time—or if an institution can bring $3.5 million to the table to balance out the budget—then great, the agency says. If not, the ship will be sold off to the highest bidder, and the money will be used to procure ship time for marine seismology with third-party contractors. “It’s just not working with this current financial and ownership model,” says Richard Murray, NSF’s director of ocean sciences in Arlington, Virginia. “We end up in a situation where the ship is tied up at the dock and not being used in different ways.”

Combined with the agency’s planned cuts to its pool of ocean-bottom seismometers, the U.S. capacity for imaging the ocean crust is on the cusp of taking a severe step back, says Douglas Wiens, a marine seismologist at Washington University in St. Louis in Missouri. “It has created a lot of anxiety for scientists who depend on this. There isn’t another way to do their research in most cases.”

One hope is that third-party ownership could free up the ship for work that government ownership doesn’t allow, Murray says. Right now, for example, LDEO can’t bid on contracts to image the Gulf of Mexico for the Department of the Interior. Also, government data policies require the public disclosure of any data Langseth acquires—a rule that makes its services a stretch for the private sector, says Sean Higgins, LDEO’s director of marine operations. But this is also a pretty small market. “This boat was really never set up to do industry work,” he says.

NSF’s request for ideas to deal with the Langseth problem came in May, on the heels of another announcement—that the agency was looking to cut its support for ocean bottom seismometers by several million dollars. With NSF’s support, three ocean research powerhouses—LDEO, the Woods Hole Oceanographic Institution, and the Scripps Institution of Oceanography—operate a pool of more than 200 of these special seismometers, which can work in concert with the airguns from ships like the Langseth, or listen for natural earthquakes. Many have been deployed recently, for example, as part of the large-scale project to study the Cascadia subduction zone off Oregon and Washington state.

NSF thinks it can save money if one institution takes over this pool of instruments. The Cascadia project and others revealed inefficiencies in how the three institutes managed the seismometers and handled their data. Streamlining their operation is “good stewardship,” Murray says. But some scientists say NSF’s proposed cuts seem to go beyond simple efficiency gains, and could mean a loss of instruments. “Downsizing the pool was not part of the Sea Change report,” Wiens says.

Marine seismologists are now feeling besieged. And many other earth scientists rely on marine seismic data to inform their global reconstructions of Earth’s interior; the possible loss of the Langseth may come as a shock to them, says Nathan Bangs, a marine seismologist at the University of Texas in Austin, who until last year led NSF’s external oversight over the ship. “A lot of earth scientists really aren’t aware of this situation.”

It’s an understandable frustration, says Murray, who wants to keep the agency’s marine seismic capabilities from declining. “We wouldn’t be going to all these lengths if we didn’t think there was a need.” Still, Bangs says he would have a hard time recommending that students enter the discipline, given its prospects. “It’s difficult to build a career on this very gloomy outlook.”

Feature: Ecology’s megaproblem

More than a decade ago, ecologist Scott Ollinger helped launch U.S. ecology’s flagship foray into big science. He and other researchers worked to transform the National Science Foundation’s (NSF’s) dream of a continental-scale observatory that would monitor environmental change into a concrete plan. What emerged was the National Ecological Observatory Network (NEON), a unique string of more than 100 data collection stations spread from Alaska to Puerto Rico.
So Ollinger was thrilled when, in 2013, NEON offered him the chance to oversee the network’s expected trove of data on long-term changes in climate, land use, biodiversity, and invasive species. He arranged for a 3-year leave of absence from his post at the University of New Hampshire in Durham. Then he hit the road to NEON’s headquarters in Boulder, Colorado.
En route, however, Ollinger learned that NSF, which is paying for NEON, had put a hold on an initial $111 million grant to begin operating some of the newly built stations.  That meant “I was almost fired the day I arrived,” he says.
The disturbing news was a harbinger of worse to come. Despite his impressive title of observatory director, Ollinger discovered that he had little influence over how NEON was being built, or the day-to-day activities of its growing scientific staff. Soon, “the number of decisions I tried to make that were overruled reached a point where I felt there was no way I could succeed,” he recalls. Frustrated and feeling powerless, Ollinger returned home after less than a year.
Ollinger’s experience reflects management problems that have dogged NEON since its birth and the project’s tense relationship with the community of scientists who will ultimately use its data. This summer those problems came home to roost.
SIDEBAR: NEON jobs plentiful but problematic
Getting a job in ecology can be tough, but the National Ecological Observatory Network (NEON) arguably has been hiring more ecologists than anyplace else; its workforce topped some 400 permanent and 100 summer employees earlier this year. But NEON’s disarray has led to high turnover and taken a toll on promising careers.
Elizabeth Webb was hired in 2014 to manage field sampling protocols and sensors at a NEON site just outside Gainesville, Florida. Webb had worked with similar instruments in Alaska while earning her master’s degree in biology, and thought her new job “would be a great opportunity to learn new things with a different setup.”
Instead, Webb says, her bosses discouraged her from showing any initiative or using her knowledge to help the fledgling project. “Someone without a college education could have done my job,” she says. For example, Webb says it took a month and several sign-offs to get approval to remove a wasp’s nest hanging from the site’s flux tower. In contrast, Webb says that she could have solved the problem with bug spray from Home Depot.
Webb quit after 5 months and now works as an outreach and facilities coordinator at the National High Magnetic Field Laboratory in Gainesville. “I really like the idea of NEON, but it’s not working,” she says. Webb “was one of my best students,” says ecologist Edward Schuur, a one-time NEON adviser who recently moved to Northern Arizona University, Flagstaff. “If NEON can’t retain people of her caliber, then something is seriously wrong with the organization.”

Todd Dawson, chair of NEON’s top scientific advisory panel, goes further. “I wouldn’t encourage a young person to apply for a NEON job now,” says the University of California, Berkeley, academic. “It’s a sad commentary. But I want to know their plans for righting the ship, and then see some real progress in achieving them, before I would advise anyone to work there.” 
On 3 August, NSF abruptly announced it was scaling back the project in an attempt to prevent an 18-month slip in its schedule and a projected cost overrun of more than $80 million on its $434 million construction budget (Science, 7 August, p. 574). On 8 September, NEON Inc., the nonprofit that manages the project, fired CEO Russ Lea, a former forestry professor and university administrator, after the head of NSF’s biology directorate, James Olds, ordered the corporation to correct “deficiencies in leadership.” And last week Olds told a congressional committee investigating what has gone wrong that NSF would consider replacing NEON Inc. if it doesn’t shape up.
NSF officials say NEON’s “descoping” was prompted by ongoing difficulties in obtaining needed site permits and technical challenges in building NEON’s sensors, some of which take novel approaches to collecting data. NEON’s supporters note that other large, complex science projects that NSF has built have undergone periodic changes in scope and leadership, particularly as they transition from construction to operations. And NEON has been especially challenging because of its complexity and uniqueness, Olds says. 
But scientists both inside and outside of NEON say the project’s woes run much deeper. They point to a chronic disharmony among NSF, NEON Inc., and the research community. Ollinger, for instance, is one of five researchers who has held—and then left—NEON’s top scientific post since 2007. This past spring, members of NEON’s chief scientific advisory body even considered a mass resignation.
Now, as NEON regroups, the scientists with whom it has had a love/hate relationship say NSF and NEON Inc. need to turn things around, and fast. “I wish them luck,” says Scott Collins, a plant biologist at the University of New Mexico, Albuquerque, who helped get NEON off the ground as an NSF program manager in the early 2000s. “They need to wake up and change the way NEON operates and get the research community behind the project,” he says. “NSF has invested a ton of money in the infrastructure,” he adds, “and if NEON fails, ecology won’t get another chance.”
WHEN THEN-NSF DIRECTOR Rita Colwell proposed what became NEON in 2000, she hoped that it would generate questions researchers had never been able to ask—or answer. Although the agency had been funding Long-Term Ecological Research sites across the United States since 1980, those projects tended to focus on hypothesis-driven research by an individual investigator. They weren’t designed to collect and share highly standardized, continental-scale data over many decades.
The move into Big Data is an intoxicating vision to many. “The idea of a community of ecologists coming together to put up a piece of infrastructure as significant as a telescope, atom smasher, or an icebreaker sucked me in,” Lea said last month, explaining why he took the CEO job in early 2012.
It took NEON’s planners a decade and several tries, however, to draw a blueprint acceptable to NSF’s oversight body and Congress. The final plan called for dividing the United States into 20 ecological domains (see map). Each domain would host two “core” observing stations chock-full of standardized sensors and sampling sites (see graphic). One core site would focus on a terrestrial ecosystem such as a forest or grassland, the other on an aquatic environment such as a stream or lake. In addition, the domains would support a total of 56 “relocatable” stations that researchers could move a few times during the 30-plus years that NEON is expected to operate. The original plan also included a long-term experiment, called STREON (STReam Experimental Observatory Network), which would simulate abrupt environmental change in aquatic ecosystems by adding nutrients—phosphates and nitrogen—and removing some organisms at 10 sites.
Since 2011, project managers have completed construction on 48 sites—fewer than half of what was in the original plan—and spent approximately two-thirds of NEON’s construction budget. The descoping preserves the 40 core sites, but eliminates 15 of the 56 relocatable sites—including seven dedicated to studying urban ecosystems. NEON also pulled the plug on two terrestrial instruments: sensors to measure fluxes of nitrogen oxides and methane, and fiber optic cables for collecting video of underground root growth. And it dropped the STREON experiment (although NSF officials emphasized that they would welcome new STREON-like proposals to another NSF funding program).
The loss of STREON was the latest defeat for aquatic scientists, who had long been unhappy with what they regarded as NEON’s inattention to its river and lake sites. In June, several prominent scientists petitioned NEON to invest more in completing the aquatic observatories. Sensing that STREON was in danger, they also asked to be consulted on any decision to drop STREON.
NEON managers rebuffed both requests, saying that “we cannot make one component of the observatory a higher priority than others.” But the descoping does exactly that, argues ecologist Walter Dodds of Kansas State University, Manhattan, who organized the petition and who has championed STREON. “It’s terrible news for aquatic scientists.”
IT’S NOT UNUSUAL for a federal agency to adjust its plans for a major scientific facility, such as a telescope or spacecraft, after construction is underway. But those changes are usually the product of discussions between scientists and project managers. On a typical NASA mission, for instance, “the job of the chief scientist is to understand the high-level science requirements of the mission and to engage in respectful conflict with the project manager to make sure that the best outcome occurs,” says David Schimel, NEON’s first CEO and later its first chief scientist. “They succeed or fail together.”
That give-and-take has not been the norm at NEON, Schimel and others say. In late 2007, for example, geophysicist Michael Keller left his job as a project scientist for a NASA-funded program in the Amazon, bought a house in Boulder, and moved his family in preparation for what he expected to be the crowning achievement of his career: chief of science at NEON. “We had a golden dream that was going to make this incredibly difficult thing happen,” he recalls. “That idealism was our calling card.”
Keller’s first task was to reach a consensus on the scientific requirements for the observatory. “Then we converted those questions into what we were going to measure and how we would report them as products” that scientists could use, he says. The result, he says, was “a very respectable final design.”
That’s when things headed south. “We fully expected to have to adapt what we were doing on a site-by-site basis,” Keller recalls. But that’s not how NSF saw things. “NSF’s model is that you do the science up front,” he says. “And once you come up with the final design, it’s up to the project manager to execute it.” The message from NSF was clear, he says: “Once we had designed it, [scientists] were somewhat obsolete.”
Ollinger says that approach may work well when building a single large facility with a clear and compelling scientific objective—he calls it a “north star”. But NEON lacks that north star, he says. Instead, its fundamental objective is to generate high-quality data that scientists will use to answer a wide array of questions.
After about 3 years at NEON, Keller “decided it was probably time for me to move on.” In late 2010 he returned to Brazil to manage a sustainable development project funded by the United States and Brazilian governments.
Keller was succeeded by the man who had hired him: Schimel. A biogeochemist who has been a tireless advocate for NEON, Schimel initially tried to recruit people who understood both ecology and what it takes to build a large scientific facility—before realizing that those two cultures rarely overlap. “It was difficult to find ecologists with experience in large projects,” Schimel says. “It was equally hard to find engineers and project managers with experience in ecology. And by difficult I mean impossible—they didn’t exist.”
Even so, Schimel says he’s proud of the team he assembled during his 5 years at NEON. But eventually he was also pushed aside. “My science role was being increasingly marginalized,” he recalls. “I was losing the authority and access to the systems engineering staff and other expertise I needed to do my job.” Schimel left NEON in 2012 to join NASA’s Jet Propulsion Laboratory in Pasadena, California, where he’s analyzing global carbon data.
Next up was Ollinger, whose year at NEON was equally disheartening. Ollinger found out that he didn’t have the promised authority to make sure that sensors passed muster before they went live at a site. Nor was he allowed to create career paths for NEON’s growing staff of scientists, who could never get a straight answer from project managers about whether they would continue to have jobs once NEON was running (see sidebar, p. 1441). A third role that Ollinger relished—figuring out how outside scientists would access NEON’s data—was impossible to fulfill, he says, because “the data weren’t flowing.”
Ollinger’s successor as observatory director, C. J. Loria, lasted just 4 months. A former Navy test pilot hired for his business acumen, Loria was ousted this past winter at the same time that NEON Inc. eliminated the position of observatory director.
The churn has deepened the rift between scientists and the project by creating a “lack of a scientific presence” at the Boulder headquarters, Lea admitted before his departure. “The community wants a mano-a-mano relationship with a strong scientific leader at NEON on a daily basis,” he said. “Scientists want to talk to their peers.”
Lea’s interim replacement as CEO is Eugene Kelly, a soil scientist at Colorado State University, Fort Collins, who only this summer was hired to be NEON’s visiting chief scientist. Kelly agrees that the research community “feels it has been kept in the dark about NEON for many years.” The low point in NEON’s relationship with the ecology community may have come this past winter, when members of its principal advisory panel, the Science, Technology and Educational Advisory Committee (STEAC), seriously considered disbanding the group.
STEAC “made several explicit recommendations over the years, and those recommendations were either ignored or opposed,” explains the panel’s chair, integrative biologist Todd Dawson of the University of California, Berkeley. “People were saying, ‘There’s no point having an advisory committee if [NEON] is not going to use it.’”
James Collins, chair of NEON’s board of directors, agrees that top management has historically shown a disregard for what scientists can bring to the project, and says that attitude must change. A biology professor at Arizona State University, Tempe, who helped get NEON off the ground as head of NSF’s biology directorate in the late 2000s, Collins says the board expects the next CEO to take a different approach. “The CEO has to set a tone in which people feel they are being treated well and their contributions are valued,” he says.
Relations between NEON Inc. and NSF also need to improve, say scientists both within and outside the project. The funding delay that sabotaged Ollinger, for example, was the result of a festering disagreement over when a site is ready to be commissioned.
It’s not a minor issue. NEON managers argue that a site should be considered operational once all the equipment works and the instruments start to generate data. Any delay in commissioning, they note, forces NEON to use construction dollars for operating costs, such as power and maintenance. That leaves less money to complete new sites.
NSF’s position, however, is that a site cannot be commissioned until its data are available online, says Elizabeth Blood, the agency’s longtime project manager for NEON. That process could add months to the commissioning process, she concedes, adding that NSF has no intention of changing its criteria.
NSF has the authority to decide the issue. But NEON’s position got a strong endorsement this past July from a high-powered panel of scientists from both inside and outside the project, which reviewed NEON’s future shortly before NSF announced the descoping. Some of NEON’s cost overruns were due to “delayed transition to operations,” the panel concluded. Its recommendation was unequivocal: “The cost of carrying field operations on the construction project is unjustified,” and NSF needed to start paying the operating costs.
Even NEON’s critics are willing to cut NSF some slack, however, because they recognize that the foundation has little political margin for error. The Republican-led science committee in the U.S. House of Representatives has repeatedly questioned whether NSF has been a proper steward of taxpayer dollars, and NEON’s missteps have provided some ammunition for those attacks. In recent months the committee has held hearings to berate NSF officials for allowing NEON Inc. to use $150,000 of its management fees on what the agency later admitted were inappropriate activities, including a Christmas party.
Last week, the panel grilled the agency on its oversight of the entire project, and Olds made it clear that the corporation is on shaky ground. “By December 1 NSF will have enough information to make a determination as to whether NEON Inc. has made sufficient improvement to successfully complete construction,” Olds told the panel. Pressed by one legislator whether that could mean replacing the current contractor, Olds hemmed and hawed before concluding, “Yes, that is an option.”
NSF has already shortened the leash. Olds said NSF is taking a closer look at the project’s financial books, and an advisory committee to the biology directorate is examining whether the descoping will affect NEON’s scientific goals. The National Science Board, NSF’s oversight body, has formed a NEON task force. Olds was also critical of NSF’s performance to date. “We could have done a better job,” he admitted.
DESPITE ITS MANY problems, NEON has made considerable progress. Managers said last month that 33 sites in 15 domains are now ready for operations. By September 2016, Lea predicts it will have “upward of 60% of final capability” at the 81 sites currently planned. The final goal, he says, is “100% of capability by the end of 2017.”
Getting to 100%, however, will require NEON to fully resolve longstanding permitting problems. NEON doesn’t own any of its sites, so before it can do any work it must obtain the permission of the landowner—whether a federal or state agency, an environmental nonprofit, a university, or private individuals. Construction also has to go through numerous environmental reviews. It all has taken much longer than anyone anticipated. “We’ve needed probably five to 10 times more permits than was originally thought,” Lea says. “It’s become a huge drain on time and resources.”
STREON posed an especially high permitting hurdle that NEON never cleared. “Dropping pollutants into a reach of streams for 30 years was a hard thing for most people to swallow,” Lea says.
NEON officials also have had to deal with everything from protests by local residents to a pair of murders that ultimately doomed an urban site in Puerto Rico (see below). In Hawaii and Alaska, the permitting process has been so problematic that this past summer NSF officials proposed dropping those two states, plus Puerto Rico, from NEON. Scientists reacted with horror, pointing out that Hawaii alone provides 25% of the climate variability across NEON sites and that, together, the three locales double the amount of biodiversity being monitored. The idea, which NSF’s Blood says was simply a trial balloon, was eventually abandoned.
SIDEBAR: Tragic end for Puerto Rico site
For many of the National Ecological Observatory Network’s (NEON’s) 80-plus monitoring sites, getting the necessary permits to begin construction was the biggest hurdle. But one site in Puerto Rico was undone by tragedy.
This past spring, two security guards were gunned down at what was to have been a “relocatable,” or movable, site in a village near Ponce. In June, NEON took down the nearly complete installation after deciding that the site, known as Mameyes, was too dangerous.
“The community said they wanted us to stay, but they couldn’t guarantee our safety,” says Russ Lea, who this month stepped down as NEON’s CEO. “They haven’t captured those responsible for the murders … so … the decision was clear.”
The local contractor had hired armed guards after construction material started disappearing from Mameyes, making it NEON’s only guarded site. In the predawn hours of 30 April, the guards were shot dead. Local authorities have declined to discuss the status of the investigation.
Although it pales next to the human tragedy, Lea says shuttering Mameyes meant abandoning a site that had required incredible resourcefulness by NEON managers. After a landslide in 1985 killed 130 people and destroyed the barrio, the remaining houses were bulldozed, and a dry forest grew up through the rubble. That history posed a special challenge to those installing the tower and monitoring equipment.
“The engineering skill needed to put that urban site into a rubble field, and not disturb the key environmental components, is a testament to what NEON is capable of achieving,” Lea says. “And then having to pull it all out—it breaks me up just to think about it.” There’s also a loss to science, as Mameyes represents a unique ecosystem within an urban setting. 
The descoping offers outside scientists a golden opportunity to reconnect with the project, Kelly says. Last month the Ecological Society of America issued a supportive letter from 16 present and past presidents. “We remain excited about the potential new science that could emerge” from NEON, they wrote, asking NSF and NEON Inc. “to re-engage with the ecological community.”

NEON will be trapping beetles at many sites.

NEON INC.

But NEON board chair Collins acknowledges that the project’s checkered history means it has a lot of ground to make up. “It still needs to prove itself to the community,” he says.

Privacy: Congratulations, aren’t you clever?

Congratulations! You successfully decoded the encrypted URL on Science’s cover (or, um, took a shortcut by following a link someone sent you). Below you’ll find a key to the data we embedded in the cover image, which include privacy-related publications and events—and potentially private details about an individual’s health, movements, and behavior. Tweet us @sciencemagazine to tell us you’ve succeeded!
LEFT STREAM
Latitude: 38.900197 | Longitude: -77.0284
Location of AAAS headquarters
goo.gl/O3p2yh
Story in the Daily Mail giving private details about an Ebola patient
44 01625 545 745
Telephone number for the ICO (“UK’s independent authority set up to uphold information rights in the public interest, promoting openness by public bodies and data privacy for individuals.”)
$612.33 at Neiman Marcus
Neiman Marcus is one of several stores that have suffered data breaches.
DOI 10.1073/pnas.0904891106
A paper that describes a way to predict Social Security numbers from public data
http://www.pnas.org/content/106/27/10975.full
ISBN-10: 0370013255
PRIVACY AND FREEDOM by Alan F. Westin (1967). The best book on privacy written in the late 20th century, according to The Washington Post
sku #22616900
Stock keeping unit number for Jimmy Choo Kascade Suede T-Strap Wedge Sandal at Neiman Marcus
078-05-1120
The most misused Social Security number ever, originally printed in a Woolworth’s ad
www.gk2gk.com
“Geek 2 Geek” dating website
CATGTTTTCAGCATTATCAGAAGGA
PCR primer sequence for HIV
MIDDLE STREAM
ISSN 1240-0068
Charlie Hebdo
CTGCTCGCGC TGTGCTGGGC
Sequence from the ApoE4 Alzheimer’s susceptibility gene
sggk://hxrn.zt/hnigbkmgh
Encrypted URL for this page (using the Atbash cipher)
US 4,200,770 
First patent covering a public-key cryptosystem
http://www.emc.com/emc-plus/rsa-labs/standards-initiatives/important-patents-in-cryptography.htm
$19.79 card purchase at Target
Target suffered a major data breach.
sku #08302855
Stock keeping unit number for Jimmy Choo Lottie Suede Crisscross Sandal at Neiman Marcus
ATEOTD IANAC
Text shorthand for “at the end of the day I am not a crook”
DOI: 10.1126/science.1058040
Human genome paper in Science
$273.99 at Kmart
Kmart suffered a data breach.
2G2BT
Text shorthand for “too good to be true”
RIGHT STREAM
COMWBSNS
SWIFT bank code for Commonwealth Bank Ltd. Head Office, Nassau, Bahamas
Latitude: 51.492762 | Longitude: -0.080152 
Location of the United Kingdom’s Secret Intelligence Service headquarters
577-48-0618
Social Security Number for Vannevar Bush, early architect of U.S. science policy, who originated concepts key to the digital age
+441719309000
Phone number for the United Kingdom’s MI5 Security Service
DOI: 10.1111/j.1083-6101.2009.01494.x
Paper on Facebook and Online Privacy: Attitudes, Behaviors, and Unintended Consequences
PubMed ID19581585
Paper on predicting Social Security numbers from public data
http://www.pnas.org/content/106/27/10975.full
http://scim.ag/1NNQB1Y
Science’s privacy quiz
053000196
Routing number for Bank of America
ISBN 978-1-62779-073-4No Place to Hide, a book about Edward Snowden
goo.gl/fTyARu
World Health Organization report on ethical principles in HIV surveillance
Short interval
Whew, that was a lot of information. But we’re not done yet—we hid some more data inside the issue, too. Below is a key to the information we embedded in page 490 of our 30 January issue. Again, don’t forget to tweet us @sciencemagazine to tell us you’ve succeeded!

WILLIAM DUKE

LEFT STREAM
CYA 2MOR 6Y
Text shorthand for “see you tomorrow, sexy”
Latitude: 36.112024 | Longitude: -115.174593
Location of the Bellagio in Las Vegas
Latitude: 39.356351 | Longitude: -74.435708
Location of Caesars Atlantic City
http://www.sciencemag.org/content/339/6117/321
The 2013 Science paper showing that anonymized public DNA sequences can reveal identities
@maltespitz
Twitter handle for Malte Spitz, German politician concerned about privacy who let a newspaper piece together his entire life and all of his movements for several months based on the records stored by his mobile phone company
PASSWORD
Most used password
IAD-RUH-KHI 
Route code for Washington Dulles-Riyadh-Karachi airports
0090-2020
ISSN for Penthouse magazine
ISBN-10: 0370013255
PRIVACY AND FREEDOM by Alan F. Westin (1967), the best book on privacy written in the late 20th century according to The Washington Post
Rx  51655-013-26
National Drug Code for the cholesterol drug lovastatin
https://firstlook.org/theintercept/
News and comment site with a focus on civil liberties
2306 chapter 858
California bill to protect people from snooping by drones
sku #11183301
Stock keeping unit number for Jimmy Choo Lance Wavy Strap Sandal at Neiman Marcus
AMT DOB 6/23/1912   Birthday of Alan Turing, cryptographer and father of digital computing
sku #22616919
Stock keeping unit number for Jimmy Choo Kascade Calf Hair Crystal-Strap Wedge Sandal at Neiman Marcushttp://bit.ly/1CegCaN
Link to poster abstract about CacheCloak location cloaking software
0028-0836
ISSN for Nature archive
www.torproject.org
A system to enable anonymous communication on the Internet
021000021
Routing number for JPMorgan Chase Bank
MIDDLE STREAM
<div class=”mtm mbs _58mr”>Birthday</div><div class=”_5k_5″><span class=”_5k_4″ data-type=”selectors” data-name=”birthday_wrapper” id=”u_0_c”>
Code from Facebook’s home page
0100001101101100011000010111010101100100011001010010000001010011011010000110000
Name of Claude Shannon, father of information theory, converted to binary numbers
GATGAGCCC CTGAAAGAGT GTCATATAAA CGAATGCTTG GTAAATAATG
Sequences from the ApoE4 Alzheimer’s susceptibility gene
US 5774670 Patent for the HTTP cookie technology
Miami PD  048305100110  SR874 South (at Turnpike)  HOMESTEAD SB  9/9/2011  3:49:26 AM  00:04:01
Police speeding data
sku #19192067
Stock keeping unit number for Jimmy Choo Aza Woven Leather Pump
0300172311
ISBN number of Nothing to Hide: The False Tradeoff between Privacy and
Security by Daniel J. Solove
http://bit.ly/1KXC9bP
A Google search for “how to protect my privacy”
FHP  109267070110  Lantana  Cypress Creek ORT South    9/11/2011  5:52:20 AM    00:12:47
Police speeding data
sggk://hxrn.zt/hnigbkmgh 
Encrypted URL for this page
id=”recaptcha_image” class=”captcha_image”></div><div id=”recaptcha_loading”>Loading…<img class=”captcha_loading img”
Code from Facebook’s home page
https://protonmail.ch/ Prototype Swiss e-mail service supposedly safe from eavesdropping
RIGHT STREAM
ISSN 1476–4687
Nature
HNL to HKG to SVO
Routing codes for Edward Snowden’s journey from Hawaii to Russia
http://1.usa.gov/152oCP1
Privacy rule in Health Insurance Portability and Accountability Act
423 Brookline Avenue
Boston address of the Personal Genome Project
TGGCGAGTGC ATCCATAAGA AGTGGCGATG
Sequence from the ApoE4 Alzheimer’s susceptibility gene
<li><a dir=”ltr” href=”https://pt-br.facebook.com/” onclick=”intl_set_cookie_locale
Code from Facebook
Directive 2009/136/EC
E.U. directive on privacy and data protection
121042882
Routing number for Wells Fargo Bank
$97.52 at Home Depot
Home Depot suffered a data breach.
441865223407
Phone number of the RUDY research project, studying rare diseases of the bones, joints, and blood vessels
グーグル株式会社に対する「通信の秘密」の保護に係る措置(指導)
Press release from Japan’s Ministry of Internal Affairs and
Communications about privacy invasions by Google Street View, 2011
03-cv-1801 05-cv-0301 01-cv-4183
Case numbers for three suits against Health Net, a company that accidentally revealed medical and financial information about large numbers of patients
http://www.gk2gk.com/
Geek 2 Geek dating site
sku #19192377
Stock keeping unit number for Jimmy Choo Abel Studded Point-Toe Pump
Rx 0002-3004-75 
National Drug Code for the antidepressant Prozac
(&quot;pt_BR&quot;, &quot;https:\/\/pt-br.facebook.com\/&quot;)
Code from Facebook
http://bit.ly/185Uvbo
A run in the Paris suburbs that somebody posted on Runtastic.com
http://bit.ly/OPF39g
Songs to Sing in the Shower, a popular Spotify playlist
https://my.pgp-hms.org/profile_public?hex=hu1F73AB
The profile of a random participant in the Personal Genome Project

How teeth got tough: enamel’s evolutionary journey

The hardest bit of your body is the enamel coating your teeth. But new analyses of fish fossils, as well as genetic analyses of a living fish species, suggest that this specialized material once served a very different function: to toughen some bones and scales of ancient fish. The findings bolster earlier suggestions that ancient fish had enamel-armored scales, and they point to a new scenario for exactly how the substance ended up on teeth.
Enamel—an almost pure layer of a 
mineral called hydroxyapatite—coats the teeth of almost all tetrapods (four-limbed creatures) and lobe-finned fish such as 
coelacanths. Most living fish do not produce it, but Per Ahlberg, a paleontologist at Uppsala University in Sweden, found an ancient exception. Well-preserved fossils of an ancient fish called Psaro-lepis romeri reveal that this 20-centimeter-long minipredator, which prowled the seas between 410 million and 415 million years ago, had enamel in its scales and its skull—but not its teeth, according to a paper by Ahlberg and colleagues in the 24 September issue of Nature.
Other teams had found partial fossils of fish with enamel on their scales. But those fragments might not have 
belonged to the same individual, Ahlberg says, so researchers couldn’t be  sure just how the enameled bits were distributed across the body, or if they came from 
individuals at different ages or developmental stages.
Ahlberg’s team instead looked at a single specimen of Psarolepis, slicing through the jawbone, skull bones, and scales to get a microscopic peek at their internal structure and so identify what they were made of. The teeth were naked dentine, the same material that underlies the enamel in your teeth and those of most modern tetrapods. But the scales and skull bones of this ancient fish included some enamel.
Researchers had suggested that over millions of years of evolution, hardened structures such as external scales gradually migrated into the mouth and changed shape to become teeth. But the patchy distribution of enamel in Psarolepis may suggest a different scenario, in which the pattern of enamel production, rather than the of shape and location of already enameled structures, shifted over time.
The team also analyzed the genome of the spotted gar 
(Lepisosteus oculatus), a modern-day species that produces a hard enamel-like material called ganoine that covers its scales. The genome shows that gar can produce two of the three proteins needed to make enamel, and suggests that ganoine is essentially a scale-coating version of enamel. Thus, it offers genetic support for the fossil evidence.
These findings “are very interesting,” says Zerina Johanson, a paleobiologist at the Natural History Museum in London. In contrast to previous ideas, the work suggests that hardened structures such as scales may not have physically moved from one place in the body to another as species evolved. Instead, evolution may have shifted the activity of enamelmaking proteins to new body parts.
“This may provide a better understanding of what was going on inside primitive vertebrates,” she says.

Society asks NIH to act now to lessen biomed scientist glut

The authors of a new report urging changes in training the U.S. biomedical workforce say they were motivated by a desire for “less talk, more action.” But their prescription for how the National Institutes of Health (NIH) should deal with a glut of young scientists demonstrates why the problem has been so hard to solve.
Report after report in recent years has decried the surfeit of young biomedical scientists stuck in seemingly endless years of training and chasing too few academic research positions. In hope of finding consensus, the American Society for Biochemistry and Molecular Biology (ASBMB) in Rockville, Maryland, combed through 267 recommendations in nine of these reports from a variety of groups that include the National Academy of Sciences and a group of postdocs. ASBMB pulled out eight suggestions common to most of the reports and presented them today in the Proceeding of the National Academy of Sciences.
A consensus already exists around many of those recommendations: NIH needs more stable funding and a larger budget, and researchers should face fewer administrative burdens. But provisions aimed specifically at young scientists are more problematic.

NIH is already trying to encourage students to consider careers outside of academia. But the report says the agency and institutions could do more. The authors also think salaries for new postdocs should rise from the current $42,840 to $50,000. NIH should limit support for graduate students to 5 years (and another 5 years for postdocs), the report says, and NIH and institutions should use fewer trainees and rely more on permanent staff scientists.
NIH should move many trainees now supported by research grants onto fellowships and training grants, which offer a better training experience, the report says. The report suggests aiming for a balance that existed in the late 1990s, when 37% of graduate students were on training grants or fellowships (compared with 32% now) and 17% of postdocs had this funding (compared with 9.6% now).
Asked about these recommendations, NIH Deputy Director for Extramural Research Sally Rockey urged caution. She says a large, 1-year raise for postdocs “could have adverse consequences for research grant budgets” coming so soon after a boost in 2014. Instead, she says, the agency is sticking to its practice of raising salaries gradually by 2% a year. 
As for the length of graduate training, she notes that NIH training grants and fellowships are already limited to 5 years. Curbing “graduate student support from any NIH source would have relatively little impact,” she says, because the average Ph.D. earns a degree in less than 7 years and the first year of support usually come from the institution. Instead, she says, NIH is focusing on the length of postdoctoral training, for example by limiting eligibility for its “kangaroo” K99/R00 awards, which combine training and an independent research grant, to applicants with no more than 4 years of postdoctoral training.
Rockey says that shifting the 60,000 graduate students and postdocs now on research grants to training grants “would not be practical or feasible, at least in the short term.” Limiting the duration of training on these grants would also be “difficult” because of differences in scientific fields and institutions, she says. Equity is another issue, she says: Some 25% of graduate students and 50% of postdocs would be shut out from the training awards because they are not U.S. citizens or permanent residents.
Authors of the ASBMB report say that they recognize some of their recommendations would upset portions of the scientific community. For example, most training grants go to large institutions; smaller schools rely on research grants to support trainees and would be hurt if those positions were curtailed, ASBMB’s Chris Pickett says. And paying postdocs more could force principal investigators to lay people off and lower productivity.
NIH may be able to smooth ruffled feathers by coordinating its actions on several fronts, say Pickett and other authors, who include the University of Pittsburgh in Pennsylvania’s Jeremy Berg, a former director of NIH’s general medical sciences institute. For example, having NIH raise postdoc salaries while simultaneously creating incentives to hire staff scientists could keep labs running and give laid off postdocs a career alternative. And NIH could keep an eye on small schools to make sure they aren’t harmed by a policy that limited trainees on research grants, Pickett says.
The ASBMB hopes to hold a meeting early next winter with the authors of some of the reports and leaders from industry and patient groups. The goal is to “hammer out a defined advocacy plan,” Pickett says. A consensus on how to process, he says, will “give NIH the OK to move forward.”

Society asks NIH to act now to lessen biomed scientist glut

The authors of a new report urging changes in training the U.S. biomedical workforce say they were motivated by a desire for “less talk, more action.” But their prescription for how the National Institutes of Health (NIH) should deal with a glut of young scientists demonstrates why the problem has been so hard to solve.
Report after report in recent years has decried the surfeit of young biomedical scientists stuck in seemingly endless years of training and chasing too few academic research positions. In hope of finding consensus, the American Society for Biochemistry and Molecular Biology (ASBMB) in Rockville, Maryland, combed through 267 recommendations in nine of these reports from a variety of groups that include the National Academy of Sciences and a group of postdocs. ASBMB pulled out eight suggestions common to most of the reports and presented them today in the Proceeding of the National Academy of Sciences.
A consensus already exists around many of those recommendations: NIH needs more stable funding and a larger budget, and researchers should face fewer administrative burdens. But provisions aimed specifically at young scientists are more problematic.

NIH is already trying to encourage students to consider careers outside of academia. But the report says the agency and institutions could do more. The authors also think salaries for new postdocs should rise from the current $42,840 to $50,000. NIH should limit support for graduate students to 5 years (and another 5 years for postdocs), the report says, and NIH and institutions should use fewer trainees and rely more on permanent staff scientists.
NIH should move many trainees now supported by research grants onto fellowships and training grants, which offer a better training experience, the report says. The report suggests aiming for a balance that existed in the late 1990s, when 37% of graduate students were on training grants or fellowships (compared with 32% now) and 17% of postdocs had this funding (compared with 9.6% now).
Asked about these recommendations, NIH Deputy Director for Extramural Research Sally Rockey urged caution. She says a large, 1-year raise for postdocs “could have adverse consequences for research grant budgets” coming so soon after a boost in 2014. Instead, she says, the agency is sticking to its practice of raising salaries gradually by 2% a year. 
As for the length of graduate training, she notes that NIH training grants and fellowships are already limited to 5 years. Curbing “graduate student support from any NIH source would have relatively little impact,” she says, because the average Ph.D. earns a degree in less than 7 years and the first year of support usually come from the institution. Instead, she says, NIH is focusing on the length of postdoctoral training, for example by limiting eligibility for its “kangaroo” K99/R00 awards, which combine training and an independent research grant, to applicants with no more than 4 years of postdoctoral training.
Rockey says that shifting the 60,000 graduate students and postdocs now on research grants to training grants “would not be practical or feasible, at least in the short term.” Limiting the duration of training on these grants would also be “difficult” because of differences in scientific fields and institutions, she says. Equity is another issue, she says: Some 25% of graduate students and 50% of postdocs would be shut out from the training awards because they are not U.S. citizens or permanent residents.
Authors of the ASBMB report say that they recognize some of their recommendations would upset portions of the scientific community. For example, most training grants go to large institutions; smaller schools rely on research grants to support trainees and would be hurt if those positions were curtailed, ASBMB’s Chris Pickett says. And paying postdocs more could force principal investigators to lay people off and lower productivity.
NIH may be able to smooth ruffled feathers by coordinating its actions on several fronts, say Pickett and other authors, who include the University of Pittsburgh in Pennsylvania’s Jeremy Berg, a former director of NIH’s general medical sciences institute. For example, having NIH raise postdoc salaries while simultaneously creating incentives to hire staff scientists could keep labs running and give laid off postdocs a career alternative. And NIH could keep an eye on small schools to make sure they aren’t harmed by a policy that limited trainees on research grants, Pickett says.
The ASBMB hopes to hold a meeting early next winter with the authors of some of the reports and leaders from industry and patient groups. The goal is to “hammer out a defined advocacy plan,” Pickett says. A consensus on how to process, he says, will “give NIH the OK to move forward.”

The sound of Proto-Indo-European

The following parable, called “The King and the God,” is based on an ancient Sanskrit hymn and is translated and recorded in Proto-Indo-European by linguist Andrew Byrd of the University of Kentucky.
H3rḗḱs dei̯u̯ós-kwe
H3rḗḱs h1est; só n̥putlós. H3rḗḱs súhxnum u̯l̥nh1to. Tósi̯o ǵʰéu̯torm̥ prēḱst: “Súhxnus moi̯ ǵn̥h1i̯etōd!” Ǵʰéu̯tōr tom h3rḗǵm̥ u̯eu̯ked: “h1i̯áǵesu̯o dei̯u̯óm U̯érunom”. Úpo h3rḗḱs dei̯u̯óm U̯érunom sesole nú dei̯u̯óm h1i̯aǵeto. “ḱludʰí moi, pter U̯erune!” Dei̯u̯ós U̯érunos diu̯és km̥tá gʷah2t. “Kʷíd u̯ēlh1si?” “Súhxnum u̯ēlh1mi.” “Tód h1estu”, u̯éu̯ked leu̯kós dei̯u̯ós U̯érunos. Nu h3réḱs pótnih2 súhxnum ǵeǵonh1e.
English translation:
The King and the God
Once there was a king. He was childless. The king wanted a son. He asked his priest: “May a son be born to me!” The priest said to the king: “Pray to the god Werunos.” The king approached the god Werunos to pray now to the god. “Hear me, father Werunos!” The god Werunos came down from heaven. “What do you want?” “I want a son.” “Let this be so,” said the bright god Werunos. The king’s lady bore a son.